tatyanamarie2851 tatyanamarie2851

Today at 9:24 AM
Social Studies

Answered

Listeners usually realize how tense a speaker is.

a. True

b. False

Answer :

shinedowner4life shinedowner4life

Today at 9:29 AM

it is very much true

Answer Link

Other Questions

Among the accomplishments of Akbar and his son Jahangir were: the establishment of libraries the Taj Mahal the ability for Hindu's to have government roles conf

Two sales representatives leave from the same office. One travels 20 miles due north and the other travels 5 miles due west. How far apart are the sales represe

Two sales representatives leave from the same office. One travels 20 miles due north and the other travels 5 miles due west. How far apart are the sales represe

Assume that the OS uses a minimum page size of 16 KB. Assume that your L1 cache must be 4-way set-associative. If you're trying to correctly implement a virtual

Your school has adopted a village as a social responsibility,Students are being taken to teach the children of that village on a regular basis. Write a report f

for the sets a = { x:x is a natural number and x is equal to or less than 100 find the following n(a) and n(nullset

Class What was the result off Olympic

roared the real colonel cathing sign of him imposter he was

a. The diagram given below shows the reflection of a ray AB. Copy the diagram and label the following: i. angle of incidence ii. angle of reflection iii. normal

An acid is a substance that increases the concentration of $

Card players who attribute their wins to their own skill and their losses to bad luck BEST illustrate a bias.

Required: 1-a. Calculate the future value at the end of three years. (FV of $1, PV of $1, FVA of $1, and PVA of $1) (Use appropriate factor(s) from the tables p

A train starts from rest at station A and accelerates at 0.5 m/s 2 for 60 s. Afterwards it travels with a constant velocity for 15 min. It then decelerates at 1

A copper block rests 17.4 cm from the center of a steel turntable. The coefficient of static friction between block and surface is 0.465. The turntable starts f

A segment of a roadway has a free flow speed of 45 mph and a jam density of 25 ft per vehicle. Determine the maximum flow and at a flow rate of 1950 vph

bramble reported total asset s of and net income of for the current year. what is the corrected amount for toal assets and net income for the yeqr

g Catalyzes a substrate level phosphorylation - breaks down sucrose to glucose and fructose - is a type of isomerase - removes one glucose residue from glycogen

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

By weight atmospheric air is approximately 23.15% oxygen and 76.85% nitrogen. What is the partial pressure of oxygen in the air at standard temperature and pres

) If the standard deviation of a random variable X is 15 and a random sample of size n=15 is obtained, what is the standard deviation of the sampling distribut