IzukuMidoriyaxx IzukuMidoriyaxx

Today at 12:25 AM
Mathematics

Answered

What is (1,4.6) across rhe y axis/reflected?

Answer :

madisongiebner7 madisongiebner7

Today at 12:30 AM

Answer:

-1,4.6

Step-by-step explanation:

if you put 1,4.6 and mirror it vertically on the graph, the x is negaive

Answer Link

jessicahamilton76 jessicahamilton76

Today at 12:31 AM

Answer—1,4,6 is your answer

Answer Link

Other Questions

Help ASAP I’ll give brainliest!!!

What type of force causes the motion of an object to change

what is the weirdest thing u saw at school asking teachers and students

What type of force causes the motion of an object to change

6.540.378 desconpone el numero de dos formas diferentes.

express the following decimal into percentage 0.25

The probability of winning a match for team A is 0.6.(a) Find the probability of winning 3 matches out of 5.(b) Find the expectation of winning the matches out

Parallel quadrilateral A B C D en AB= 6 cm,BC =4.5 cm and BD = 7.5cm. incomponents

Number Systems(16. If x = 13 +2/3, find the value of x-117. If x= 2 + 73, find the value of x' +1.

If A = {3,9,27,81}, then write A in the set builder form.

A tank has 120 gallons of water and is being drained at a rate of 12 gallon each second. Another tank has 100 gallons of water and is being drained at a rate of

a pair of boots were $45 they were on sale for $38.25 what percent were they off

if Suzannah's budget limit is $10 per month, how many text messages can she send in one month?

help pls it due today and i.d.k. what to do the one that said mean thats is the understanding o i but i dont understand it

What does the imagery in this scene help the reader understand about Mother Wolf?

How can Australia achieve economic growth

Which of these statements are correct about two parallel lines in a coordinate plane? Select three that apply.

Trees are a natural resource in Arkansas. They are often harvested for lumber. How does Arkansas keep this natural resource from being depleted? (1.7 Arkansas G

I will mark someone brainliest! Please help!!

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-