samanthamyrthil samanthamyrthil

Today at 3:26 PM
Mathematics

Answered

A box is filled with 5 red crayons,9 blue crayons,and 6 yellow crayons. A crayon is chosen at random from the box. Find the probability that it is a red or blue crayon. Write your answer as a fraction in simplest from.

Answer :

softpretzels27 softpretzels27

Today at 3:31 PM

There are 20 crayons in the box, 14 of them or red or blue.

14/20 can be simplified to 7/10.

Answer Link

Other Questions

A(n) converts your voice's sound waves into digital signals.

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the

During the Gilded Age the US population rose from 15 million in 1830 to nearly 30 million in 1850. from 15 million in 1830 to nearly 40 million in 1870. from ne

Among all forms of life, humans stand out as the only species that

appropriateBy09-84+$.

Please please answer correctly who will ans correctly i will mark your ans in brainliest ans and who will ans rubbish their ans will be reported immediate

[tex](7xy) \sec( \csc( log{ \cos( \tan( \sin(?) ) ) }(?) ) ) [/tex]

Notice localhost mistake?

MY FABRICS IS SUPERIOR elaborate this topic in 250 to 300

A company received a bill for newspaper advertising services received, $400. The bill will be paid in 10 days. How would the transaction be recorded today

A reflection of triangle abc to triangle a'b'c' is shown. Which transformation makes this reflection? A) (x', y') = (y, x) B) (x', y') = (x, -y) C) (x', y') = (

What would happen if the pacific plate continues to move?

A collection of pitches arranged in ascending and descending order constitutes a:

What were northern soldiers called in the civil war besides union?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

What was the first stage of hitler's blitzkrieg strategy?

A bottle-nosed dolphin can travel about 2 miles in 5 minutes. At this rate, how long does it take the dolphin to travel 8 miles?

Heather wants to buy a new tent. she so far has saved $23 and her parents have told her that any remaining money she saves they will match. if the tent costs $1

What was the difference between old and new immigrants?